Geoduck RRBS Library Prep
Prepping RRBS libraries for geoduck juvenile OA acclimatization study.
20161201
Chose 12 samples from a single time point (Day 10, 3 treatments * 4 replicates) for the first sequencing library preps. 100ng was used as the starting amount of DNA for each sample and the volume of water in each reaction was adjusted as necessary. 0.5% unmethylated lambda DNA was spiked in (w/w DNA) to determine conversion efficiency by estimating the error rate at which a C count occurs at an unmethylated C position
Step 1 MSPI DNA Cutting
MSPI restriction endonuclease in NEBuffer2
- MspI - 25,000U (NEB cat: R0106L)
- NEBuffer2 10x (NEB cat: B7002S)
Reaction Mix
- Samples were mixed as follows to a total reaction volume of 30µl. Samples were incubated at 37°C starting at 15:00
- Lambda DNA (581ng/µl) was diluted 1:1160 for a concentration of 0.5ng/µl and 1µl added to each sample
-
Unmethylated lamda phage DNA (Promega cat: D1501)
- 3µl NEBuffer2
- 1µl MSPI 20U/µl
- 16µl DNA (100ng)
- 10µl of H20
- 30µl total
| EPI.Tube.Num | Tank | Treatment | DNA.Extraction | DNA.Conc.ng.µl | vol.for.100ng | lambda.0.5% | Water.µl | NSBuffer2.µl | MSPI.µl |
|---|---|---|---|---|---|---|---|---|---|
| EPI_103 | Tank11 | Low | 20161028 | 18.3 | 5.5 | 1 | 19.5 | 3 | 1 |
| EPI_104 | Tank11 | Low | 20161007 | 9.28 | 10.8 | 1 | 14.2 | 3 | 1 |
| EPI_111 | Tank12 | Super.Low | 20161007 | 55.6 | 1.8 | 1 | 23.2 | 3 | 1 |
| EPI_113 | Tank12 | Super.Low | 20161007 | 18.8 | 5.3 | 1 | 19.7 | 3 | 1 |
| EPI_119 | Tank13 | Ambient | 20161007 | 17.6 | 5.7 | 1 | 19.3 | 3 | 1 |
| EPI_120 | Tank13 | Ambient | 20161007 | 16.5 | 6.1 | 1 | 18.9 | 3 | 1 |
| EPI_127 | Tank14 | Low | 20161004 | 35.2 | 2.8 | 1 | 22.2 | 3 | 1 |
| EPI_128 | Tank14 | Low | 20161004 | 29.8 | 3.4 | 1 | 21.6 | 3 | 1 |
| EPI_135 | Tank15 | Ambient | 20161004 | 20.2 | 5 | 1 | 20 | 3 | 1 |
| EPI_136 | Tank15 | Ambient | 20161004 | 18.2 | 5.5 | 1 | 19.5 | 3 | 1 |
| EPI_143 | Tank16 | Super.Low | 20161028 | 41.2 | 2.4 | 1 | 22.6 | 3 | 1 |
| EPI_145 | Tank16 | Super.Low | 20161007 | 9.64 | 10.4 | 1 | 14.6 | 3 | 1 |
Step 1 conclusions
- no errors were seen on the PCR machine. Samples assumed to have been cut with MSPI
Step 2 Bisulfite conversion
- Removed from incubator at 09:45 on 20161202
- Proceeded with EZ DNA Methylation-Gold Kit (Catalog Nos. D5005 & D5006) EZ DNA Methylation-Gold Manual
Samples
Added additional samples to compare RRBS above with whole genome library preps
| EPI.Tube.Num | Tank | Treatment | DNA.Extraction | DNA.Conc.ng.µl | vol.for.100ng | lambda.0.5% | Water.µl |
|---|---|---|---|---|---|---|---|
| EPI_111 | Tank12 | Super.Low | 20161007 | 55.6 | 1.8 | 1 | 27.2 |
| EPI_128 | Tank14 | Low | 20161004 | 29.8 | 3.4 | 1 | 25.6 |
| EPI_135 | Tank15 | Ambient | 20161004 | 20.2 | 5 | 1 | 24.0 |
- EPI_111 - Whole Genome sample, no MSPI cutting
- EPI_128 - Whole Genome sample, no MSPI cutting
- EPI_135 - Whole Genome sample, no MSPI cutting
Bisulfite conversion kit prep
-
Prepared the CT Conversion Reagent for larger DNA samples (30µl) by adding 800µl of water, 300µl of M-Dilution and 50µl of M-Dissolving
- Added 30µl of sample described in table to 120 µl of CT Conversion Reagent, mixed by flicking, and spun down
- Placed tubes in PCR machine at 10:45 and set as follows:
- 98°C for 10 min
- 64°C for 2.5 hours
- 4°C forever
-
followed protocol steps EZ DNA Methylation-Gold Manual
-
Eluted in 12µl of elution buffer
- 1µl was used to quantify the samples on the nanodrop
| Sample.ID | ng/µl |
|---|---|
| EPI_103 | 18.06 |
| EPI_104 | 19.39 |
| EPI_111 | 19.43 |
| EPI_113 | 18.76 |
| EPI_119 | 18.83 |
| EPI_120 | 20.48 |
| EPI_127 | 21.31 |
| EPI_128 | 22.01 |
| EPI_135 | 21.56 |
| EPI_136 | 20.35 |
| EPI_143 | 19.92 |
| EPI_145 | 19.99 |
| EPI_111 WG | 23.04 |
| EPI_128 WG | 23.69 |
| EPI_135 WG | 23.63 |
- 1µl was used to assess fragment size on the bioanalyzer.
Bisulfite converted ssDNA assessment
Expected DNA size for Gold kit (A)
Results of bisulfite converted samples
- size quantification on sample 111-wg does not seem to be displaying correctly
- Gel marker is offset
Step 2 conclusions
- All samples are of approptiate size to continue with library prep
Step 3 Illumina Library Prep
Ilumina TruSeq DNA Methylation Library Preparation Guide
Illumina Adapter Sequences Document # 1000000002694 v01 17 February 2016 TruSeq DNA Methylation Index PCR Primers 5’ CAAGCAGAAGACGGCATACGAGAT[6 bases]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
- Index 1: ATCACG
- Index 2: CGATGT
- Index 3: TTAGGC
- Index 4: TGACCA
- Index 5: ACAGTG
- Index 6: GCCAAT
- Index 7: CAGATC
- Index 8: ACTTGA
- Index 9: GATCAG
- Index 10: TAGCTT
- Index 11: GGCTAC
- Index 12: CTTGTA
Illumina library prep was completed according to manufacturer’s instructions with modifications as described in red text on the protocol and listed below.
- samples eluted in 12µl post BS conversion
- 200µl of 80% ethanol used for rinsing beads
- Samples were stored at -20 for ~24h between Purify the Tagged DNA and Amplify the Library and Add an Index steps
- Library prep was started 20161202
- Library prep was finished 20121204
- Individual barcodes were used for each sample from the Illumina TruSeq DNA Methylation Index PCR Primers (10 reactions, 12 indexes Cat #: EGIDX81312)
| Sample.ID | Index.Number | Index.Sequence |
|---|---|---|
| EPI_103 | 1 | ATCACG |
| EPI_104 | 2 | CGATGT |
| EPI_111 | 3 | TTAGGC |
| EPI_113 | 4 | TGACCA |
| EPI_119 | 5 | ACAGTG |
| EPI_120 | 6 | GCCAAT |
| EPI_127 | 7 | CAGATC |
| EPI_128 | 8 | ACTTGA |
| EPI_135 | 9 | GATCAG |
| EPI_136 | 10 | TAGCTT |
| EPI_143 | 11 | GGCTAC |
| EPI_145 | 12 | CTTGTA |
| EPI_111 WG | 1 | ATCACG |
| EPI_128 WG | 2 | CGATGT |
| EPI_135 WG | 3 | TTAGGC |
Library Quantification
20161205 Libraries were quantified on the Qubit using the dsDNA High Sensitivity Kit
- Samples were loaded 1µl of library + 199µl of Qubit dye/buffer mix (1:200)
-
Standards were loaded 10µl of standard + 190µl of Qubit dye/buffer mix (1:200)
- Illumin indicates samples should be >3ng/µl
| Sample.ID | ng/µl |
|---|---|
| EPI_103 | 4.34 |
| EPI_104 | 4.80 |
| EPI_111 | 5.46 |
| EPI_113 | 4.88 |
| EPI_119 | 5.10 |
| EPI_120 | 4.58 |
| EPI_127 | 4.58 |
| EPI_128 | 4.80 |
| EPI_135 | 4.08 |
| EPI_136 | 3.70 |
| EPI_143 | 2.88 |
| EPI_145 | 2.92 |
| EPI_111 WG | 3.40 |
| EPI_128 WG | 4.12 |
| EPI_135 WG | 2.24 |
Library Quality
Libraries were not concentrated enough to measure using Agilent DNA 12000 kit 20161204
- 1µl of sample was used for each and no data were visible with DNA 12000 kit
20161205
- 1.0µl of each sample was run on the Agilent DNA High Sensitivity Kit
- A few diluted DNA samples were also run in extra cells to view original DNA with more resolution
Illumina DNA Methylation kit expected library size on high sensitivity chip
- EPI_103
- EPI_104
- EPI_111
- EPI_113
- EPI_119
- EPI_120
- EPI_127
- EPI_128
- EPI_135
- EPI_136
- EPI_143
- EPI_1451
- EPI_145
- EPI_111 WG
- EPI_128 WG
- EPI_135 WG
- EPI_103 DNA Diluted 1:1
- EPI_104 DNA Diluted 1:1
- EPI_111 DNA Diluted 1:10
- EPI_113 DNA Diluted 1:1
- EPI_119 DNA Diluted 1:1
- EPI_128 DNA Diluted 1:3
-
EPI_135 DNA Diluted 1:3
- Original DNA samples overloaded the chip sensitivity and data are not useful
RRBS Library Prep Conclusions
- samples have the correct quantity of ~3ng/µl and more than enough ~15µl (45ng) to load for sequencing
- library size ranges from 150bp to 1000bp and peaks just around 300bp, which matches the expected range in the kit guide
- There does not appear to be a difference in library size between whole genome and RRBS preps as seen in the traces of the RRBS chip 2 results
- libraries appear to be of good quality for sequencing
Library Pooling for seqeuncing submission
Libraries were diluted to 10nM and pooled 2µl each for a pooled sample of 10nM in 24µl
Samples were sent to Genewiz on 20161213
| Day | Lane | Sample.ID | Library Concentration (ng/uL) | Library Concentration (ug/uL) | Library Volume (uL) | Molecular Weight pmol/660pg | 10^6pg/ug | DNA Size 1/N (N = bp) | pmol DNA | Library Concentration (uM) | Library Concentration (nM) | Dilution Factor for 10nM | Vol Library added µl | Vol Elution Buffer µl |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Day10 | Lane1 | EPI_103 | 4.34 | 0.0043 | 15 | 0.002 | 1000000 | 0.0033 | 0.33 | 0.022 | 21.92 | 0.46 | 1.8 | 2.2 |
| Day10 | Lane1 | EPI_104 | 4.8 | 0.0048 | 15 | 0.002 | 1000000 | 0.0033 | 0.36 | 0.024 | 24.24 | 0.41 | 1.7 | 2.4 |
| Day10 | Lane1 | EPI_111 | 5.46 | 0.0055 | 15 | 0.002 | 1000000 | 0.0033 | 0.41 | 0.028 | 27.58 | 0.36 | 1.5 | 2.5 |
| Day10 | Lane1 | EPI_113 | 4.88 | 0.0049 | 15 | 0.002 | 1000000 | 0.0033 | 0.37 | 0.025 | 24.65 | 0.41 | 1.6 | 2.4 |
| Day10 | Lane1 | EPI_119 | 5.1 | 0.0051 | 15 | 0.002 | 1000000 | 0.0033 | 0.39 | 0.026 | 25.76 | 0.39 | 1.6 | 2.4 |
| Day10 | Lane1 | EPI_120 | 4.58 | 0.0046 | 15 | 0.002 | 1000000 | 0.0033 | 0.35 | 0.023 | 23.13 | 0.43 | 1.7 | 2.3 |
| Day10 | Lane1 | EPI_127 | 4.58 | 0.0046 | 15 | 0.002 | 1000000 | 0.0033 | 0.35 | 0.023 | 23.13 | 0.43 | 1.7 | 2.3 |
| Day10 | Lane1 | EPI_128 | 4.8 | 0.0048 | 15 | 0.002 | 1000000 | 0.0033 | 0.36 | 0.024 | 24.24 | 0.41 | 1.7 | 2.4 |
| Day10 | Lane1 | EPI_135 | 4.08 | 0.0041 | 15 | 0.002 | 1000000 | 0.0033 | 0.31 | 0.021 | 20.61 | 0.49 | 1.9 | 2.1 |
| Day10 | Lane1 | EPI_136 | 3.7 | 0.0037 | 15 | 0.002 | 1000000 | 0.0033 | 0.28 | 0.019 | 18.69 | 0.54 | 2.1 | 1.9 |
| Day10 | Lane1 | EPI_143 | 2.88 | 0.0029 | 15 | 0.002 | 1000000 | 0.0033 | 0.22 | 0.015 | 14.55 | 0.69 | 2.8 | 1.3 |
| Day10 | Lane1 | EPI_145 | 2.92 | 0.0029 | 15 | 0.002 | 1000000 | 0.0033 | 0.22 | 0.015 | 14.75 | 0.68 | 2.7 | 1.3 |
Sample QC at Genewiz
20161216
Samples passed QC and were confirmed for sequencing on a single lane of Illumina Highseq2500 2x100bp on 20161219